Multi-Locus Sequence Typing (MLST) is a procedure adopted for characterising leptospiral isolates, using the DNA sequences of internal fragments of multiple genes. Approximately 400-700 bp internal fragments of each gene are generally used.
MLST directly measures the DNA sequence variations in a set of genes and characterizes strains by their unique allelic profiles. Hence this technique can be used in strains or isolates representing sub-types or sub-species to identify polymorphic regions of different genes among them to find out consensus sequences of particular speciesor sub-species.
The technique for speciation of leptospires, utilizes six genes namely, adk (Adenylate Kinase), icdA (Isocitrate dehydrogenase), lipL32 (outer membrane lipoprotein LipL32), rrs2 (16S rRNA), secY (pre-protein translocaseSecY protein), and lipL41 (outer membrane Lipoprotein LipL41).
The primer sequences are
adk (F-GGGCTGGAAAAGGTACACAA, RACGCAAGCTCCTTTTGAATC)
icdA (F-GGGACGAGATGACCAGGAT, R-TTTTTTGAGATCCGCAGCTTT)
lipL32 (F-ATCTCCGTTGCACTCTTTGC, R-ACCATCATCATCATCGTCCA)
rrs2 (FCATGCAAGTCAAGCGGAGTA, R-AGTTGAGCCCGCAGTTTTC)
secY (F-ATGCCGATCATTTTTGCTTC,RCCGTCCCTTAATTTTAGACTTCTTC)
lipL41 (F-AGGAAATTGCGCAGCTACA, RGCATCGAGAGGAATTAACATCA)
Leptospires are grown in EMJH liquid media, and the genomic DNA is extracted during Log phase using standard protocols.PCR amplifications of the different MLST target genes are performed using 1.5 mM MgCl2, 200 μM of dNTPs (MBI Fermentas) and 25-50 ng of template DNA using GeneAmp 9700 PCR system. Amplification parameters included an initial denaturation at 95°C for 5 min followed by 35 cycles of amplification comprising of denaturation (94°C for 30 sec), annealing (58°C for 30 sec) and primer extension (72°C for 1 min) steps and a final extension of 7 min at 72°C. All the amplified fragments are sequenced using DNA sequencer.
Sequences are compared with dendograms by usingChromas Lite version 2.01 and the resulting DNA sequences are aligned using the Seqscape software. All the sequences are subsequently aligned by Clustal X. The phylogenetic analysis is carried out for representative strains/isolates based on a 'super locus' of 2980bp comprising concatenated sequence of all the six loci with known sequences (Sequences are available at the Data base of RMRC (ICMR) Port Blair, can be obtained on request)using MEGA 3.1.Instead of 6 genes mentioned above, 3 genes namely, lipL32, lipL41 and secY is also provides similar results. Therefore, super locus of 1543bp construction is performed by adjoining of all three sequences and compared with the known genes by MEGA software
For any further details, please contact:
Head, Bio-informatics Division
Regional Medical Research Centre (ICMR) Port Blair
Landline: 03192 251158
Fax: 03192 251163
E-mail: directorrmrc@gmail.com, pblicmr@sancharnet.in